Read the Instruction Word Document fully and you are provided two pdf example papers I made, and I want you to look over as well. Do not use these for your chosen topic but do take inspiration in how I tackled mine and how I structured it. I would like you to structure the work you will be making similar to how I did it.
Category: Biology
Please watch both video links and write 3 paragraphs on what you learned. – Please use APA references at least 2.
Attached is a discussion topic in the first attachment; the second part is to respond (2nd attachment) to the student example provided (3rd attachment). Here is the link to the article mentioned in the discussion topic: https://www.sciencedirect.com/science/article/pii/S1413867012001341?via%3Dihub
Your assigned reading over the past two weeks has introduced you to the structure and function of DNA.
Write a brief outline of the mechanisms in which DNA is used to generate protein. You do not need to provide a fine level of detail, but ensure you reflect on the key points in the process and mention any major differences between the mechanism in prokaryotic and eukaryotic cells
Although the DNA in our genes is considered to be the heritable genetic material, other factors, including the environment are considered to play an important role in the activity and expression of those genes. Summarize the role that epigenetics & developmental epigenetics play in health & disease.
Finally – using the codon table found in Figure 15.4 in Chapter 15 of the textbook, translate these two almost identical RNA strands into peptide sequences, using the first base of each as the first triplet in a codon. You will notice that the second strand has a point deletion (the u in bold) with respect to the first strand – comment on how this has affected the resulting peptide chain.
aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc
aguuguaucgaaaacugcgaguaaauauccugagggcgcgaagcaaccYour assigned reading over the past two weeks has introduced you to the structure and function of DNA.
Write a brief outline of the mechanisms in which DNA is used to generate protein. You do not need to provide a fine level of detail, but ensure you reflect on the key points in the process and mention any major differences between the mechanism in prokaryotic and eukaryotic cells
Although the DNA in our genes is considered to be the heritable genetic material, other factors, including the environment are considered to play an important role in the activity and expression of those genes. Summarize the role that epigenetics & developmental epigenetics play in health & disease.
Finally – using the codon table found in Figure 15.4 in Chapter 15 of the textbook, translate these two almost identical RNA strands into peptide sequences, using the first base of each as the first triplet in a codon. You will notice that the second strand has a point deletion (the u in bold) with respect to the first strand – comment on how this has affected the resulting peptide chain.
aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc
aguuguaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc
You are a doctor in a hospital, and a patient is experiencing trouble with her skin repairing itself from a cut. The patient is also expecting a child, but the cells in the reproduction development are experiencing malfunction in cell division.
Describe the stages of each type of cell reproduction process from a normal patient whose body cells can repair themselves and normal cell division during the reproductive development of the unborn baby.
Explain the disadvantages and advantages of each type of cell division.
Discuss how the patient experiencing problems with the cells repairing from the cut and the child’s reproduction development malfunctions can alter haploid and diploid cell development.
Length/Formatting Instructions:
Length: 1000 Words
Font: 12 point , Calibri Font, no more than 1″ margins
Program/File Type Submit in Word
Referencing system: APA referencing system is necessary in assignments, especially material copied from the Internet.
For examples of correct citations, visit the following links:
http://owl.english.purdue.edu/owl/resource/560/01/
Here are some links to help:
Clues to Chromosome Crossovers in Meiosis.
Davis, A. (2013). Clues to Chromosome Crossovers in Meiosis. Retrieved October 24, 2016, from https://www.sciencedaily.com/releases/2013/02/130213152420.htm
What is Meiosis?
Vidyasagar, A. (2015). What is Meiosis? Retrieved October 24, 2016, from https://www.livescience.com/52489-meiosis.html
The Photosynthesis and Respiration Game:
B. (2018). Bioman Biology. The Photosynthesis and Respiration Game. Retrieved from https://www.biomanbio.com/HTML5GamesandLabs/PhotoRespgames/photoresphtml5page.html
Photosynthesis Interactive!:
B. (2018). Bioman Biology. Photosynthesis Interactive! Retrieved from https://www.biomanbio.com/HTML5GamesandLabs/PhotoRespgames/photointeractivehtml5page.html
Cell Division:
B. (2018). Quizlet. Cell Division. Retrieved from https://quizlet.com/237547/cell-division-flash-cards/
Videos
ATP and Respiration: Crash Course Biology #7:
C. (2012, March 12). Youtube. ATP and Respiration: Crash Course Biology #7. [Video file]. Retrieved from https://www.youtube.com/watch?v=00jbG_cfGuQ
Photosynthesis: Crash Course Biology #8:
C. (2012, March 19). Youtube. Photosynthesis: Crash Course Biology #8. [Video file]. Retrieved from https://www.youtube.com/watch?v=sQK3Yr4Sc_k
Mitosis: Splitting Up is Complicated – Crash Course Biology #12:
C. (2012, April 16). Youtube. Mitosis: Splitting Up is Complicated – Crash Course Biology #12. [Video file]. Retrieved from https://www.youtube.com/watch?v=L0k-enzoeOM
Meiosis: Where the Sex Starts – Crash Course Biology #13:
C. (2012, April 23). Youtube. Meiosis: Where the Sex Starts – Crash Course Biology #13. [Video file]. Retrieved from https://www.youtube.com/watch?v=qCLmR9-YY7o
Some people like to read books, while others like to watch or play sports. Clearly, everyone prefers some activities over others. Why do you think this is? Consider choices you make concerning your own entertainment. Why do you like to do the things you do? Why does it feel good to you to do them while they might not appeal as much to someone else? Do genetics play a part in your decisions?
Your journal entry must be at least 200 words in length. No references or citations are necessary
need to select a movie and write a research paper on how the movie relates to biology, I selected contagion. Please edit and correct and add. I will put paper in chat. somehow unable to attach.
Outline of summative assessment
• students will work individually or in pairs to design their own experiment to test the reaction time between
• it is known that dominant hand will probably have a faster reaction time, your task is to design an experiment to test that claim, use the results of your investigation to either support or reject that claim.
YouTube video:
Follow the instructions and do a lab report on the experiment. Please label everything you do for example
Hypothesis:
Claim:
Data:
Variables:
Etc….
proving hypothesis is true by planing lab experiments, such as western blot, immunofluorescence staining, and such.
Cell bio lab report: for introduction part include some relative information from the attached article